ID: 1203449944

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:102816-102838
Sequence TTGGGAGGCTGTGGAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203449938_1203449944 22 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449944 Un_GL000219v1:102816-102838 TTGGGAGGCTGTGGAGAAAAGGG No data
1203449937_1203449944 28 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449944 Un_GL000219v1:102816-102838 TTGGGAGGCTGTGGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203449944 Original CRISPR TTGGGAGGCTGTGGAGAAAA GGG Intergenic
No off target data available for this crispr