ID: 1203465269

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:80110-80132
Sequence CAGGACCCATAACATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203465260_1203465269 -1 Left 1203465260 Un_GL000220v1:80088-80110 CCCCATCTTCTGGTAACATGCCC No data
Right 1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG No data
1203465262_1203465269 -3 Left 1203465262 Un_GL000220v1:80090-80112 CCATCTTCTGGTAACATGCCCAG No data
Right 1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG No data
1203465261_1203465269 -2 Left 1203465261 Un_GL000220v1:80089-80111 CCCATCTTCTGGTAACATGCCCA No data
Right 1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203465269 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr