ID: 1203468007

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:104961-104983
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203468007_1203468016 -9 Left 1203468007 Un_GL000220v1:104961-104983 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203468016 Un_GL000220v1:104975-104997 CCGGGGAGCGGTCCCCGGGCCGG No data
1203468007_1203468018 -2 Left 1203468007 Un_GL000220v1:104961-104983 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203468018 Un_GL000220v1:104982-105004 GCGGTCCCCGGGCCGGGCCGCGG No data
1203468007_1203468017 -8 Left 1203468007 Un_GL000220v1:104961-104983 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203468017 Un_GL000220v1:104976-104998 CGGGGAGCGGTCCCCGGGCCGGG No data
1203468007_1203468025 22 Left 1203468007 Un_GL000220v1:104961-104983 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203468025 Un_GL000220v1:105006-105028 CCCTCTGCCGCGATCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203468007 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr