ID: 1203468303

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:105976-105998
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203468303_1203468316 1 Left 1203468303 Un_GL000220v1:105976-105998 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203468316 Un_GL000220v1:106000-106022 GTGTGGGAAGGCGTGGGGTGCGG No data
1203468303_1203468314 -5 Left 1203468303 Un_GL000220v1:105976-105998 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203468314 Un_GL000220v1:105994-106016 CGGTGCGTGTGGGAAGGCGTGGG No data
1203468303_1203468315 -4 Left 1203468303 Un_GL000220v1:105976-105998 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203468315 Un_GL000220v1:105995-106017 GGTGCGTGTGGGAAGGCGTGGGG No data
1203468303_1203468313 -6 Left 1203468303 Un_GL000220v1:105976-105998 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203468313 Un_GL000220v1:105993-106015 GCGGTGCGTGTGGGAAGGCGTGG No data
1203468303_1203468317 8 Left 1203468303 Un_GL000220v1:105976-105998 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203468317 Un_GL000220v1:106007-106029 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203468303 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr