ID: 1203468330

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:106049-106071
Sequence CCCCGCGACGCAGAAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203468330_1203468340 3 Left 1203468330 Un_GL000220v1:106049-106071 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203468340 Un_GL000220v1:106075-106097 GCCGGCGGGGTCCTCTGACGCGG No data
1203468330_1203468339 -10 Left 1203468330 Un_GL000220v1:106049-106071 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203468339 Un_GL000220v1:106062-106084 CGTCGCGGGGCGGGCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203468330 Original CRISPR CCCCGCGACGCAGAAGGCGG CGG (reversed) Intergenic
No off target data available for this crispr