ID: 1203469175

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:108727-108749
Sequence GCGCGCGCGCGCGTGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203469170_1203469175 -5 Left 1203469170 Un_GL000220v1:108709-108731 CCCGCGGGCGCCGGCCGCGCGCG No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469166_1203469175 6 Left 1203469166 Un_GL000220v1:108698-108720 CCTCGCCGCCGCCCGCGGGCGCC No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469171_1203469175 -6 Left 1203469171 Un_GL000220v1:108710-108732 CCGCGGGCGCCGGCCGCGCGCGC No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469165_1203469175 9 Left 1203469165 Un_GL000220v1:108695-108717 CCGCCTCGCCGCCGCCCGCGGGC No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469169_1203469175 -2 Left 1203469169 Un_GL000220v1:108706-108728 CCGCCCGCGGGCGCCGGCCGCGC No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469161_1203469175 11 Left 1203469161 Un_GL000220v1:108693-108715 CCCCGCCTCGCCGCCGCCCGCGG No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469168_1203469175 1 Left 1203469168 Un_GL000220v1:108703-108725 CCGCCGCCCGCGGGCGCCGGCCG No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469160_1203469175 15 Left 1203469160 Un_GL000220v1:108689-108711 CCGTCCCCGCCTCGCCGCCGCCC No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data
1203469163_1203469175 10 Left 1203469163 Un_GL000220v1:108694-108716 CCCGCCTCGCCGCCGCCCGCGGG No data
Right 1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203469175 Original CRISPR GCGCGCGCGCGCGTGGCCGC CGG Intergenic