ID: 1203469883

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:111690-111712
Sequence GACGGCCGCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203469883_1203469899 25 Left 1203469883 Un_GL000220v1:111690-111712 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469883_1203469894 -4 Left 1203469883 Un_GL000220v1:111690-111712 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469883_1203469895 -1 Left 1203469883 Un_GL000220v1:111690-111712 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203469895 Un_GL000220v1:111712-111734 CGGGTGGGGGCTTTACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203469883 Original CRISPR GACGGCCGCCGCGGCGGCGG CGG (reversed) Intergenic