ID: 1203469894

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:111709-111731
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203469883_1203469894 -4 Left 1203469883 Un_GL000220v1:111690-111712 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469887_1203469894 -10 Left 1203469887 Un_GL000220v1:111696-111718 CCGCCGCGGCGGCCGTCGGGTGG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469870_1203469894 30 Left 1203469870 Un_GL000220v1:111656-111678 CCGCGGACTCCGCTCCCCGGCCG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469874_1203469894 21 Left 1203469874 Un_GL000220v1:111665-111687 CCGCTCCCCGGCCGGGGCCGCGC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469876_1203469894 15 Left 1203469876 Un_GL000220v1:111671-111693 CCCGGCCGGGGCCGCGCCGCCGC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469875_1203469894 16 Left 1203469875 Un_GL000220v1:111670-111692 CCCCGGCCGGGGCCGCGCCGCCG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469879_1203469894 4 Left 1203469879 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469885_1203469894 -7 Left 1203469885 Un_GL000220v1:111693-111715 CCGCCGCCGCGGCGGCCGTCGGG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469882_1203469894 -1 Left 1203469882 Un_GL000220v1:111687-111709 CCGCCGCCGCCGCCGCGGCGGCC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469877_1203469894 14 Left 1203469877 Un_GL000220v1:111672-111694 CCGGCCGGGGCCGCGCCGCCGCC No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data
1203469878_1203469894 10 Left 1203469878 Un_GL000220v1:111676-111698 CCGGGGCCGCGCCGCCGCCGCCG No data
Right 1203469894 Un_GL000220v1:111709-111731 CGTCGGGTGGGGGCTTTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203469894 Original CRISPR CGTCGGGTGGGGGCTTTACC CGG Intergenic