ID: 1203469899

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:111738-111760
Sequence TCGCGCGCCTGCCGCGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203469891_1203469899 16 Left 1203469891 Un_GL000220v1:111699-111721 CCGCGGCGGCCGTCGGGTGGGGG No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469887_1203469899 19 Left 1203469887 Un_GL000220v1:111696-111718 CCGCCGCGGCGGCCGTCGGGTGG No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469885_1203469899 22 Left 1203469885 Un_GL000220v1:111693-111715 CCGCCGCCGCGGCGGCCGTCGGG No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469882_1203469899 28 Left 1203469882 Un_GL000220v1:111687-111709 CCGCCGCCGCCGCCGCGGCGGCC No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469893_1203469899 7 Left 1203469893 Un_GL000220v1:111708-111730 CCGTCGGGTGGGGGCTTTACCCG No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data
1203469883_1203469899 25 Left 1203469883 Un_GL000220v1:111690-111712 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203469899 Un_GL000220v1:111738-111760 TCGCGCGCCTGCCGCGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203469899 Original CRISPR TCGCGCGCCTGCCGCGCGTG TGG Intergenic