ID: 1203469900

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:111745-111767
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203469900_1203469904 -9 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469904 Un_GL000220v1:111759-111781 GGCGTGCGCCCCGCGCCGTGGGG No data
1203469900_1203469903 -10 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469903 Un_GL000220v1:111758-111780 TGGCGTGCGCCCCGCGCCGTGGG No data
1203469900_1203469914 15 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469914 Un_GL000220v1:111783-111805 CGGGAACCCCCGGGCGCCTGTGG No data
1203469900_1203469916 17 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469916 Un_GL000220v1:111785-111807 GGAACCCCCGGGCGCCTGTGGGG No data
1203469900_1203469915 16 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469915 Un_GL000220v1:111784-111806 GGGAACCCCCGGGCGCCTGTGGG No data
1203469900_1203469911 5 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469911 Un_GL000220v1:111773-111795 GCCGTGGGGGCGGGAACCCCCGG No data
1203469900_1203469907 -4 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469907 Un_GL000220v1:111764-111786 GCGCCCCGCGCCGTGGGGGCGGG No data
1203469900_1203469917 20 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469917 Un_GL000220v1:111788-111810 ACCCCCGGGCGCCTGTGGGGTGG No data
1203469900_1203469913 6 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469913 Un_GL000220v1:111774-111796 CCGTGGGGGCGGGAACCCCCGGG No data
1203469900_1203469905 -8 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469905 Un_GL000220v1:111760-111782 GCGTGCGCCCCGCGCCGTGGGGG No data
1203469900_1203469906 -5 Left 1203469900 Un_GL000220v1:111745-111767 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203469906 Un_GL000220v1:111763-111785 TGCGCCCCGCGCCGTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203469900 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic