ID: 1203471378

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116651-116673
Sequence CGGCGCCCGCCGGGCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471378_1203471399 27 Left 1203471378 Un_GL000220v1:116651-116673 CCCGGGGAGCCCGGCGGGCGCCG No data
Right 1203471399 Un_GL000220v1:116701-116723 CGTCGCGCGCGCGTCCGCTGGGG No data
1203471378_1203471397 25 Left 1203471378 Un_GL000220v1:116651-116673 CCCGGGGAGCCCGGCGGGCGCCG No data
Right 1203471397 Un_GL000220v1:116699-116721 CTCGTCGCGCGCGCGTCCGCTGG No data
1203471378_1203471400 28 Left 1203471378 Un_GL000220v1:116651-116673 CCCGGGGAGCCCGGCGGGCGCCG No data
Right 1203471400 Un_GL000220v1:116702-116724 GTCGCGCGCGCGTCCGCTGGGGG No data
1203471378_1203471398 26 Left 1203471378 Un_GL000220v1:116651-116673 CCCGGGGAGCCCGGCGGGCGCCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471378 Original CRISPR CGGCGCCCGCCGGGCTCCCC GGG (reversed) Intergenic