ID: 1203471379

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116652-116674
Sequence CCGGCGCCCGCCGGGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471379_1203471400 27 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471400 Un_GL000220v1:116702-116724 GTCGCGCGCGCGTCCGCTGGGGG No data
1203471379_1203471397 24 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471397 Un_GL000220v1:116699-116721 CTCGTCGCGCGCGCGTCCGCTGG No data
1203471379_1203471401 30 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG No data
1203471379_1203471398 25 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471379_1203471399 26 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471399 Un_GL000220v1:116701-116723 CGTCGCGCGCGCGTCCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471379 Original CRISPR CCGGCGCCCGCCGGGCTCCC CGG (reversed) Intergenic
No off target data available for this crispr