ID: 1203471382

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116661-116683
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471382_1203471402 22 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471402 Un_GL000220v1:116706-116728 CGCGCGCGTCCGCTGGGGGCGGG No data
1203471382_1203471403 23 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471403 Un_GL000220v1:116707-116729 GCGCGCGTCCGCTGGGGGCGGGG No data
1203471382_1203471400 18 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471400 Un_GL000220v1:116702-116724 GTCGCGCGCGCGTCCGCTGGGGG No data
1203471382_1203471398 16 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471382_1203471404 28 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471404 Un_GL000220v1:116712-116734 CGTCCGCTGGGGGCGGGGAGCGG No data
1203471382_1203471401 21 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG No data
1203471382_1203471397 15 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471397 Un_GL000220v1:116699-116721 CTCGTCGCGCGCGCGTCCGCTGG No data
1203471382_1203471399 17 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471399 Un_GL000220v1:116701-116723 CGTCGCGCGCGCGTCCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471382 Original CRISPR GGGGGCGCGCCGGCGCCCGC CGG (reversed) Intergenic