ID: 1203471392

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116687-116709
Sequence CGCGCGACGAGACGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471392_1203471399 -9 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471399 Un_GL000220v1:116701-116723 CGTCGCGCGCGCGTCCGCTGGGG No data
1203471392_1203471406 6 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471406 Un_GL000220v1:116716-116738 CGCTGGGGGCGGGGAGCGGTCGG No data
1203471392_1203471412 23 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471412 Un_GL000220v1:116733-116755 GGTCGGGCGGCGGCGGTCGGCGG No data
1203471392_1203471410 16 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471392_1203471411 20 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471411 Un_GL000220v1:116730-116752 AGCGGTCGGGCGGCGGCGGTCGG No data
1203471392_1203471403 -3 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471403 Un_GL000220v1:116707-116729 GCGCGCGTCCGCTGGGGGCGGGG No data
1203471392_1203471398 -10 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471392_1203471408 10 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471408 Un_GL000220v1:116720-116742 GGGGGCGGGGAGCGGTCGGGCGG No data
1203471392_1203471401 -5 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG No data
1203471392_1203471407 7 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471392_1203471404 2 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471404 Un_GL000220v1:116712-116734 CGTCCGCTGGGGGCGGGGAGCGG No data
1203471392_1203471400 -8 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471400 Un_GL000220v1:116702-116724 GTCGCGCGCGCGTCCGCTGGGGG No data
1203471392_1203471402 -4 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471402 Un_GL000220v1:116706-116728 CGCGCGCGTCCGCTGGGGGCGGG No data
1203471392_1203471409 13 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471409 Un_GL000220v1:116723-116745 GGCGGGGAGCGGTCGGGCGGCGG No data
1203471392_1203471415 30 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471392_1203471414 27 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471392_1203471413 24 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471413 Un_GL000220v1:116734-116756 GTCGGGCGGCGGCGGTCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471392 Original CRISPR CGCGCGACGAGACGTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr