ID: 1203471398

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116700-116722
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471390_1203471398 -8 Left 1203471390 Un_GL000220v1:116685-116707 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471385_1203471398 -3 Left 1203471385 Un_GL000220v1:116680-116702 CCCCCCCCCCACCCCACGTCTCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471383_1203471398 6 Left 1203471383 Un_GL000220v1:116671-116693 CCGGCGCGCCCCCCCCCCCACCC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471392_1203471398 -10 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471384_1203471398 -2 Left 1203471384 Un_GL000220v1:116679-116701 CCCCCCCCCCCACCCCACGTCTC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471387_1203471398 -5 Left 1203471387 Un_GL000220v1:116682-116704 CCCCCCCCACCCCACGTCTCGTC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471386_1203471398 -4 Left 1203471386 Un_GL000220v1:116681-116703 CCCCCCCCCACCCCACGTCTCGT No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471388_1203471398 -6 Left 1203471388 Un_GL000220v1:116683-116705 CCCCCCCACCCCACGTCTCGTCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471378_1203471398 26 Left 1203471378 Un_GL000220v1:116651-116673 CCCGGGGAGCCCGGCGGGCGCCG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471382_1203471398 16 Left 1203471382 Un_GL000220v1:116661-116683 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471379_1203471398 25 Left 1203471379 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471376_1203471398 28 Left 1203471376 Un_GL000220v1:116649-116671 CCCCCGGGGAGCCCGGCGGGCGC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471381_1203471398 17 Left 1203471381 Un_GL000220v1:116660-116682 CCCGGCGGGCGCCGGCGCGCCCC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471389_1203471398 -7 Left 1203471389 Un_GL000220v1:116684-116706 CCCCCCACCCCACGTCTCGTCGC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471391_1203471398 -9 Left 1203471391 Un_GL000220v1:116686-116708 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data
1203471377_1203471398 27 Left 1203471377 Un_GL000220v1:116650-116672 CCCCGGGGAGCCCGGCGGGCGCC No data
Right 1203471398 Un_GL000220v1:116700-116722 TCGTCGCGCGCGCGTCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471398 Original CRISPR TCGTCGCGCGCGCGTCCGCT GGG Intergenic
No off target data available for this crispr