ID: 1203471405

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116715-116737
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471405_1203471416 3 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471416 Un_GL000220v1:116741-116763 GGCGGCGGTCGGCGGGCGGCGGG No data
1203471405_1203471413 -4 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471413 Un_GL000220v1:116734-116756 GTCGGGCGGCGGCGGTCGGCGGG No data
1203471405_1203471411 -8 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471411 Un_GL000220v1:116730-116752 AGCGGTCGGGCGGCGGCGGTCGG No data
1203471405_1203471418 7 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471418 Un_GL000220v1:116745-116767 GCGGTCGGCGGGCGGCGGGGCGG No data
1203471405_1203471417 4 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471417 Un_GL000220v1:116742-116764 GCGGCGGTCGGCGGGCGGCGGGG No data
1203471405_1203471420 9 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471420 Un_GL000220v1:116747-116769 GGTCGGCGGGCGGCGGGGCGGGG No data
1203471405_1203471414 -1 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471405_1203471419 8 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471419 Un_GL000220v1:116746-116768 CGGTCGGCGGGCGGCGGGGCGGG No data
1203471405_1203471412 -5 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471412 Un_GL000220v1:116733-116755 GGTCGGGCGGCGGCGGTCGGCGG No data
1203471405_1203471415 2 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471405_1203471421 12 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471421 Un_GL000220v1:116750-116772 CGGCGGGCGGCGGGGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471405 Original CRISPR CGACCGCTCCCCGCCCCCAG CGG (reversed) Intergenic