ID: 1203471407

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116717-116739
Sequence GCTGGGGGCGGGGAGCGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471384_1203471407 15 Left 1203471384 Un_GL000220v1:116679-116701 CCCCCCCCCCCACCCCACGTCTC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471391_1203471407 8 Left 1203471391 Un_GL000220v1:116686-116708 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471392_1203471407 7 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471393_1203471407 6 Left 1203471393 Un_GL000220v1:116688-116710 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471388_1203471407 11 Left 1203471388 Un_GL000220v1:116683-116705 CCCCCCCACCCCACGTCTCGTCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471389_1203471407 10 Left 1203471389 Un_GL000220v1:116684-116706 CCCCCCACCCCACGTCTCGTCGC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471387_1203471407 12 Left 1203471387 Un_GL000220v1:116682-116704 CCCCCCCCACCCCACGTCTCGTC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471390_1203471407 9 Left 1203471390 Un_GL000220v1:116685-116707 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471386_1203471407 13 Left 1203471386 Un_GL000220v1:116681-116703 CCCCCCCCCACCCCACGTCTCGT No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471396_1203471407 1 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471385_1203471407 14 Left 1203471385 Un_GL000220v1:116680-116702 CCCCCCCCCCACCCCACGTCTCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471395_1203471407 2 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471394_1203471407 3 Left 1203471394 Un_GL000220v1:116691-116713 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data
1203471383_1203471407 23 Left 1203471383 Un_GL000220v1:116671-116693 CCGGCGCGCCCCCCCCCCCACCC No data
Right 1203471407 Un_GL000220v1:116717-116739 GCTGGGGGCGGGGAGCGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471407 Original CRISPR GCTGGGGGCGGGGAGCGGTC GGG Intergenic
No off target data available for this crispr