ID: 1203471407 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Un_GL000220v1:116717-116739 |
Sequence | GCTGGGGGCGGGGAGCGGTC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 14 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203471407 | Original CRISPR | GCTGGGGGCGGGGAGCGGTC GGG | Intergenic | ||