ID: 1203471410

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116726-116748
Sequence GGGGAGCGGTCGGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471388_1203471410 20 Left 1203471388 Un_GL000220v1:116683-116705 CCCCCCCACCCCACGTCTCGTCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471385_1203471410 23 Left 1203471385 Un_GL000220v1:116680-116702 CCCCCCCCCCACCCCACGTCTCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471384_1203471410 24 Left 1203471384 Un_GL000220v1:116679-116701 CCCCCCCCCCCACCCCACGTCTC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471387_1203471410 21 Left 1203471387 Un_GL000220v1:116682-116704 CCCCCCCCACCCCACGTCTCGTC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471390_1203471410 18 Left 1203471390 Un_GL000220v1:116685-116707 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471394_1203471410 12 Left 1203471394 Un_GL000220v1:116691-116713 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471392_1203471410 16 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471395_1203471410 11 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471393_1203471410 15 Left 1203471393 Un_GL000220v1:116688-116710 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471391_1203471410 17 Left 1203471391 Un_GL000220v1:116686-116708 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471396_1203471410 10 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471389_1203471410 19 Left 1203471389 Un_GL000220v1:116684-116706 CCCCCCACCCCACGTCTCGTCGC No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data
1203471386_1203471410 22 Left 1203471386 Un_GL000220v1:116681-116703 CCCCCCCCCACCCCACGTCTCGT No data
Right 1203471410 Un_GL000220v1:116726-116748 GGGGAGCGGTCGGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471410 Original CRISPR GGGGAGCGGTCGGGCGGCGG CGG Intergenic