ID: 1203471414

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116737-116759
Sequence GGGCGGCGGCGGTCGGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471393_1203471414 26 Left 1203471393 Un_GL000220v1:116688-116710 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471395_1203471414 22 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471389_1203471414 30 Left 1203471389 Un_GL000220v1:116684-116706 CCCCCCACCCCACGTCTCGTCGC No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471392_1203471414 27 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471390_1203471414 29 Left 1203471390 Un_GL000220v1:116685-116707 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471391_1203471414 28 Left 1203471391 Un_GL000220v1:116686-116708 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471405_1203471414 -1 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471396_1203471414 21 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data
1203471394_1203471414 23 Left 1203471394 Un_GL000220v1:116691-116713 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203471414 Un_GL000220v1:116737-116759 GGGCGGCGGCGGTCGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471414 Original CRISPR GGGCGGCGGCGGTCGGCGGG CGG Intergenic