ID: 1203471415

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116740-116762
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471394_1203471415 26 Left 1203471394 Un_GL000220v1:116691-116713 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471393_1203471415 29 Left 1203471393 Un_GL000220v1:116688-116710 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471405_1203471415 2 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471396_1203471415 24 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471392_1203471415 30 Left 1203471392 Un_GL000220v1:116687-116709 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data
1203471395_1203471415 25 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471415 Original CRISPR CGGCGGCGGTCGGCGGGCGG CGG Intergenic
No off target data available for this crispr