ID: 1203471417

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116742-116764
Sequence GCGGCGGTCGGCGGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471405_1203471417 4 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471417 Un_GL000220v1:116742-116764 GCGGCGGTCGGCGGGCGGCGGGG No data
1203471395_1203471417 27 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471417 Un_GL000220v1:116742-116764 GCGGCGGTCGGCGGGCGGCGGGG No data
1203471394_1203471417 28 Left 1203471394 Un_GL000220v1:116691-116713 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203471417 Un_GL000220v1:116742-116764 GCGGCGGTCGGCGGGCGGCGGGG No data
1203471396_1203471417 26 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471417 Un_GL000220v1:116742-116764 GCGGCGGTCGGCGGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471417 Original CRISPR GCGGCGGTCGGCGGGCGGCG GGG Intergenic
No off target data available for this crispr