ID: 1203471418

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:116745-116767
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471395_1203471418 30 Left 1203471395 Un_GL000220v1:116692-116714 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203471418 Un_GL000220v1:116745-116767 GCGGTCGGCGGGCGGCGGGGCGG No data
1203471396_1203471418 29 Left 1203471396 Un_GL000220v1:116693-116715 CCACGTCTCGTCGCGCGCGCGTC No data
Right 1203471418 Un_GL000220v1:116745-116767 GCGGTCGGCGGGCGGCGGGGCGG No data
1203471405_1203471418 7 Left 1203471405 Un_GL000220v1:116715-116737 CCGCTGGGGGCGGGGAGCGGTCG No data
Right 1203471418 Un_GL000220v1:116745-116767 GCGGTCGGCGGGCGGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471418 Original CRISPR GCGGTCGGCGGGCGGCGGGG CGG Intergenic