ID: 1203471791

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:118425-118447
Sequence GCGCGCGCGCGCGCGTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471786_1203471791 4 Left 1203471786 Un_GL000220v1:118398-118420 CCTCGACACAAGGGTTTGTCCGC No data
Right 1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG No data
1203471785_1203471791 5 Left 1203471785 Un_GL000220v1:118397-118419 CCCTCGACACAAGGGTTTGTCCG No data
Right 1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471791 Original CRISPR GCGCGCGCGCGCGCGTGCGG GGG Intergenic