ID: 1203471995

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:119037-119059
Sequence CGGAGCGTCCCCGTCTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203471986_1203471995 18 Left 1203471986 Un_GL000220v1:118996-119018 CCGAGCGGCGTGTAGGAGTGCCC No data
Right 1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG No data
1203471990_1203471995 -3 Left 1203471990 Un_GL000220v1:119017-119039 CCGTCGGGACGAACCGCAACCGG No data
Right 1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG No data
1203471983_1203471995 27 Left 1203471983 Un_GL000220v1:118987-119009 CCTTCTCCACCGAGCGGCGTGTA No data
Right 1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG No data
1203471985_1203471995 21 Left 1203471985 Un_GL000220v1:118993-119015 CCACCGAGCGGCGTGTAGGAGTG No data
Right 1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG No data
1203471989_1203471995 -2 Left 1203471989 Un_GL000220v1:119016-119038 CCCGTCGGGACGAACCGCAACCG No data
Right 1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203471995 Original CRISPR CGGAGCGTCCCCGTCTCGGT CGG Intergenic
No off target data available for this crispr