ID: 1203473923

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:134573-134595
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203473923_1203473933 3 Left 1203473923 Un_GL000220v1:134573-134595 CCGGCTCCCCCCACTACCCACGT No data
Right 1203473933 Un_GL000220v1:134599-134621 TTCACCTTAATTTAGTGAGTCGG No data
1203473923_1203473935 8 Left 1203473923 Un_GL000220v1:134573-134595 CCGGCTCCCCCCACTACCCACGT No data
Right 1203473935 Un_GL000220v1:134604-134626 CTTAATTTAGTGAGTCGGTTAGG No data
1203473923_1203473936 11 Left 1203473923 Un_GL000220v1:134573-134595 CCGGCTCCCCCCACTACCCACGT No data
Right 1203473936 Un_GL000220v1:134607-134629 AATTTAGTGAGTCGGTTAGGTGG No data
1203473923_1203473937 12 Left 1203473923 Un_GL000220v1:134573-134595 CCGGCTCCCCCCACTACCCACGT No data
Right 1203473937 Un_GL000220v1:134608-134630 ATTTAGTGAGTCGGTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203473923 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr