ID: 1203474234

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:137453-137475
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203474230_1203474234 -6 Left 1203474230 Un_GL000220v1:137436-137458 CCCACCGAGGTCAAATGGATACC No data
Right 1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG No data
1203474232_1203474234 -10 Left 1203474232 Un_GL000220v1:137440-137462 CCGAGGTCAAATGGATACCTCTG No data
Right 1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG No data
1203474226_1203474234 11 Left 1203474226 Un_GL000220v1:137419-137441 CCGCAAAGCTGACCTGTCCCACC No data
Right 1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG No data
1203474231_1203474234 -7 Left 1203474231 Un_GL000220v1:137437-137459 CCACCGAGGTCAAATGGATACCT No data
Right 1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG No data
1203474228_1203474234 -1 Left 1203474228 Un_GL000220v1:137431-137453 CCTGTCCCACCGAGGTCAAATGG No data
Right 1203474234 Un_GL000220v1:137453-137475 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203474234 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr