ID: 1203474387

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:138043-138065
Sequence AATCTATTTTGTGGCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203474387_1203474394 5 Left 1203474387 Un_GL000220v1:138043-138065 CCCTTGAGGCCACAAAATAGATT No data
Right 1203474394 Un_GL000220v1:138071-138093 CCACCCATCGACGTTTCCCCCGG No data
1203474387_1203474395 6 Left 1203474387 Un_GL000220v1:138043-138065 CCCTTGAGGCCACAAAATAGATT No data
Right 1203474395 Un_GL000220v1:138072-138094 CACCCATCGACGTTTCCCCCGGG No data
1203474387_1203474398 12 Left 1203474387 Un_GL000220v1:138043-138065 CCCTTGAGGCCACAAAATAGATT No data
Right 1203474398 Un_GL000220v1:138078-138100 TCGACGTTTCCCCCGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203474387 Original CRISPR AATCTATTTTGTGGCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr