ID: 1203474399

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:138087-138109
Sequence AGGATACATCCAGCACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203474399_1203474407 24 Left 1203474399 Un_GL000220v1:138087-138109 CCCCCGGGTGCTGGATGTATCCT No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203474399 Original CRISPR AGGATACATCCAGCACCCGG GGG (reversed) Intergenic
No off target data available for this crispr