ID: 1203474407

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:138134-138156
Sequence GTCGAATTAAACACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203474399_1203474407 24 Left 1203474399 Un_GL000220v1:138087-138109 CCCCCGGGTGCTGGATGTATCCT No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data
1203474400_1203474407 23 Left 1203474400 Un_GL000220v1:138088-138110 CCCCGGGTGCTGGATGTATCCTG No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data
1203474402_1203474407 21 Left 1203474402 Un_GL000220v1:138090-138112 CCGGGTGCTGGATGTATCCTGTC No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data
1203474401_1203474407 22 Left 1203474401 Un_GL000220v1:138089-138111 CCCGGGTGCTGGATGTATCCTGT No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data
1203474404_1203474407 -8 Left 1203474404 Un_GL000220v1:138119-138141 CCTGAGCCTGACACCGTCGAATT No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data
1203474403_1203474407 4 Left 1203474403 Un_GL000220v1:138107-138129 CCTGTCAAGAGACCTGAGCCTGA No data
Right 1203474407 Un_GL000220v1:138134-138156 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203474407 Original CRISPR GTCGAATTAAACACCTTGAC TGG Intergenic
No off target data available for this crispr