ID: 1203475828

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:148933-148955
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203475828_1203475837 -9 Left 1203475828 Un_GL000220v1:148933-148955 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203475837 Un_GL000220v1:148947-148969 CCGGGGAGCGGTCCCCGGGCCGG No data
1203475828_1203475838 -8 Left 1203475828 Un_GL000220v1:148933-148955 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203475838 Un_GL000220v1:148948-148970 CGGGGAGCGGTCCCCGGGCCGGG No data
1203475828_1203475839 -2 Left 1203475828 Un_GL000220v1:148933-148955 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203475839 Un_GL000220v1:148954-148976 GCGGTCCCCGGGCCGGGCCGCGG No data
1203475828_1203475846 22 Left 1203475828 Un_GL000220v1:148933-148955 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203475846 Un_GL000220v1:148978-149000 CCCTCTGCCGCGATCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203475828 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr