ID: 1203476124

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:149948-149970
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476124_1203476136 -4 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476136 Un_GL000220v1:149967-149989 GGTGCGTGTGGGAAGGCGTGGGG No data
1203476124_1203476134 -6 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476134 Un_GL000220v1:149965-149987 GCGGTGCGTGTGGGAAGGCGTGG No data
1203476124_1203476138 8 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476138 Un_GL000220v1:149979-150001 AAGGCGTGGGGTGCGGACCCCGG No data
1203476124_1203476135 -5 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476124_1203476137 1 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476124 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr