ID: 1203476135

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:149966-149988
Sequence CGGTGCGTGTGGGAAGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476121_1203476135 5 Left 1203476121 Un_GL000220v1:149938-149960 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476115_1203476135 22 Left 1203476115 Un_GL000220v1:149921-149943 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476125_1203476135 -10 Left 1203476125 Un_GL000220v1:149953-149975 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476119_1203476135 7 Left 1203476119 Un_GL000220v1:149936-149958 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476120_1203476135 6 Left 1203476120 Un_GL000220v1:149937-149959 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476117_1203476135 18 Left 1203476117 Un_GL000220v1:149925-149947 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476116_1203476135 19 Left 1203476116 Un_GL000220v1:149924-149946 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476118_1203476135 17 Left 1203476118 Un_GL000220v1:149926-149948 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data
1203476124_1203476135 -5 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476135 Un_GL000220v1:149966-149988 CGGTGCGTGTGGGAAGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476135 Original CRISPR CGGTGCGTGTGGGAAGGCGT GGG Intergenic
No off target data available for this crispr