ID: 1203476137

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:149972-149994
Sequence GTGTGGGAAGGCGTGGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476116_1203476137 25 Left 1203476116 Un_GL000220v1:149924-149946 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476127_1203476137 -6 Left 1203476127 Un_GL000220v1:149955-149977 CCGCCCGCCGGCGGTGCGTGTGG No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476120_1203476137 12 Left 1203476120 Un_GL000220v1:149937-149959 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476118_1203476137 23 Left 1203476118 Un_GL000220v1:149926-149948 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476121_1203476137 11 Left 1203476121 Un_GL000220v1:149938-149960 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476126_1203476137 -5 Left 1203476126 Un_GL000220v1:149954-149976 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476130_1203476137 -9 Left 1203476130 Un_GL000220v1:149958-149980 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476117_1203476137 24 Left 1203476117 Un_GL000220v1:149925-149947 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476115_1203476137 28 Left 1203476115 Un_GL000220v1:149921-149943 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476131_1203476137 -10 Left 1203476131 Un_GL000220v1:149959-149981 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476119_1203476137 13 Left 1203476119 Un_GL000220v1:149936-149958 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476124_1203476137 1 Left 1203476124 Un_GL000220v1:149948-149970 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data
1203476125_1203476137 -4 Left 1203476125 Un_GL000220v1:149953-149975 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1203476137 Un_GL000220v1:149972-149994 GTGTGGGAAGGCGTGGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476137 Original CRISPR GTGTGGGAAGGCGTGGGGTG CGG Intergenic
No off target data available for this crispr