ID: 1203476151

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:150021-150043
Sequence CCCCGCGACGCAGAAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476151_1203476160 -10 Left 1203476151 Un_GL000220v1:150021-150043 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203476160 Un_GL000220v1:150034-150056 CGTCGCGGGGCGGGCCGGCGGGG No data
1203476151_1203476161 3 Left 1203476151 Un_GL000220v1:150021-150043 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203476161 Un_GL000220v1:150047-150069 GCCGGCGGGGTCCTCTGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476151 Original CRISPR CCCCGCGACGCAGAAGGCGG CGG (reversed) Intergenic
No off target data available for this crispr