ID: 1203476245

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:150329-150351
Sequence CTGAGGGAGCTCGTCGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476229_1203476245 17 Left 1203476229 Un_GL000220v1:150289-150311 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476222_1203476245 30 Left 1203476222 Un_GL000220v1:150276-150298 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476232_1203476245 15 Left 1203476232 Un_GL000220v1:150291-150313 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476230_1203476245 16 Left 1203476230 Un_GL000220v1:150290-150312 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476233_1203476245 12 Left 1203476233 Un_GL000220v1:150294-150316 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476227_1203476245 24 Left 1203476227 Un_GL000220v1:150282-150304 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476236_1203476245 2 Left 1203476236 Un_GL000220v1:150304-150326 CCGCCGCGGTGTCCGCGCGTGGG No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476234_1203476245 9 Left 1203476234 Un_GL000220v1:150297-150319 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476241_1203476245 -10 Left 1203476241 Un_GL000220v1:150316-150338 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476228_1203476245 18 Left 1203476228 Un_GL000220v1:150288-150310 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476226_1203476245 25 Left 1203476226 Un_GL000220v1:150281-150303 CCCGGCGCCCCCTCCTCCGGTCG No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476225_1203476245 26 Left 1203476225 Un_GL000220v1:150280-150302 CCCCGGCGCCCCCTCCTCCGGTC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476238_1203476245 -1 Left 1203476238 Un_GL000220v1:150307-150329 CCGCGGTGTCCGCGCGTGGGTCC No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data
1203476224_1203476245 27 Left 1203476224 Un_GL000220v1:150279-150301 CCCCCGGCGCCCCCTCCTCCGGT No data
Right 1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476245 Original CRISPR CTGAGGGAGCTCGTCGGTGT GGG Intergenic
No off target data available for this crispr