ID: 1203476996

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:152699-152721
Sequence GCGCGCGCGCGCGTGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203476987_1203476996 6 Left 1203476987 Un_GL000220v1:152670-152692 CCTCGCCGCCGCCCGCGGGCGCC No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476982_1203476996 11 Left 1203476982 Un_GL000220v1:152665-152687 CCCCGCCTCGCCGCCGCCCGCGG No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476990_1203476996 -2 Left 1203476990 Un_GL000220v1:152678-152700 CCGCCCGCGGGCGCCGGCCGCGC No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476991_1203476996 -5 Left 1203476991 Un_GL000220v1:152681-152703 CCCGCGGGCGCCGGCCGCGCGCG No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476986_1203476996 9 Left 1203476986 Un_GL000220v1:152667-152689 CCGCCTCGCCGCCGCCCGCGGGC No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476984_1203476996 10 Left 1203476984 Un_GL000220v1:152666-152688 CCCGCCTCGCCGCCGCCCGCGGG No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476992_1203476996 -6 Left 1203476992 Un_GL000220v1:152682-152704 CCGCGGGCGCCGGCCGCGCGCGC No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476981_1203476996 15 Left 1203476981 Un_GL000220v1:152661-152683 CCGTCCCCGCCTCGCCGCCGCCC No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data
1203476989_1203476996 1 Left 1203476989 Un_GL000220v1:152675-152697 CCGCCGCCCGCGGGCGCCGGCCG No data
Right 1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203476996 Original CRISPR GCGCGCGCGCGCGTGGCCGC CGG Intergenic