ID: 1203477704

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:155662-155684
Sequence GACGGCCGCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203477704_1203477716 -1 Left 1203477704 Un_GL000220v1:155662-155684 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203477716 Un_GL000220v1:155684-155706 CGGGTGGGGGCTTTACCCGGCGG No data
1203477704_1203477720 25 Left 1203477704 Un_GL000220v1:155662-155684 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203477720 Un_GL000220v1:155710-155732 TCGCGCGCCTGCCGCGCGTGTGG No data
1203477704_1203477715 -4 Left 1203477704 Un_GL000220v1:155662-155684 CCGCCGCCGCCGCGGCGGCCGTC No data
Right 1203477715 Un_GL000220v1:155681-155703 CGTCGGGTGGGGGCTTTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203477704 Original CRISPR GACGGCCGCCGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr