ID: 1203477721

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:155717-155739
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203477721_1203477728 -4 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477728 Un_GL000220v1:155736-155758 GCGCCCCGCGCCGTGGGGGCGGG No data
1203477721_1203477732 5 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477732 Un_GL000220v1:155745-155767 GCCGTGGGGGCGGGAACCCCCGG No data
1203477721_1203477734 6 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477734 Un_GL000220v1:155746-155768 CCGTGGGGGCGGGAACCCCCGGG No data
1203477721_1203477724 -10 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477724 Un_GL000220v1:155730-155752 TGGCGTGCGCCCCGCGCCGTGGG No data
1203477721_1203477735 15 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477735 Un_GL000220v1:155755-155777 CGGGAACCCCCGGGCGCCTGTGG No data
1203477721_1203477726 -8 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477726 Un_GL000220v1:155732-155754 GCGTGCGCCCCGCGCCGTGGGGG No data
1203477721_1203477738 20 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477738 Un_GL000220v1:155760-155782 ACCCCCGGGCGCCTGTGGGGTGG No data
1203477721_1203477736 16 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477736 Un_GL000220v1:155756-155778 GGGAACCCCCGGGCGCCTGTGGG No data
1203477721_1203477727 -5 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477727 Un_GL000220v1:155735-155757 TGCGCCCCGCGCCGTGGGGGCGG No data
1203477721_1203477737 17 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477737 Un_GL000220v1:155757-155779 GGAACCCCCGGGCGCCTGTGGGG No data
1203477721_1203477725 -9 Left 1203477721 Un_GL000220v1:155717-155739 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203477725 Un_GL000220v1:155731-155753 GGCGTGCGCCCCGCGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203477721 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic