ID: 1203478600

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:158435-158457
Sequence CGTCGCCGGGGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203478600_1203478622 5 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478622 Un_GL000220v1:158463-158485 GGTGCCGCGCGCGGGTCGGGGGG No data
1203478600_1203478617 -3 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478617 Un_GL000220v1:158455-158477 ACGGGGGGGGTGCCGCGCGCGGG No data
1203478600_1203478619 2 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478619 Un_GL000220v1:158460-158482 GGGGGTGCCGCGCGCGGGTCGGG No data
1203478600_1203478621 4 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478621 Un_GL000220v1:158462-158484 GGGTGCCGCGCGCGGGTCGGGGG No data
1203478600_1203478623 8 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478623 Un_GL000220v1:158466-158488 GCCGCGCGCGGGTCGGGGGGCGG No data
1203478600_1203478618 1 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478618 Un_GL000220v1:158459-158481 GGGGGGTGCCGCGCGCGGGTCGG No data
1203478600_1203478626 10 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478626 Un_GL000220v1:158468-158490 CGCGCGCGGGTCGGGGGGCGGGG No data
1203478600_1203478620 3 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478620 Un_GL000220v1:158461-158483 GGGGTGCCGCGCGCGGGTCGGGG No data
1203478600_1203478627 13 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478627 Un_GL000220v1:158471-158493 GCGCGGGTCGGGGGGCGGGGCGG No data
1203478600_1203478625 9 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478625 Un_GL000220v1:158467-158489 CCGCGCGCGGGTCGGGGGGCGGG No data
1203478600_1203478616 -4 Left 1203478600 Un_GL000220v1:158435-158457 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203478616 Un_GL000220v1:158454-158476 GACGGGGGGGGTGCCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203478600 Original CRISPR CGTCGCCGGGGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr