ID: 1203479222

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000220v1:160677-160699
Sequence GCGCGCGCGTCCGCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203479200_1203479222 30 Left 1203479200 Un_GL000220v1:160624-160646 CCGGGGAGCCCGGCGGGCGCCGG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479210_1203479222 -2 Left 1203479210 Un_GL000220v1:160656-160678 CCCCCCACCCCACGTCTCGTCGC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479202_1203479222 22 Left 1203479202 Un_GL000220v1:160632-160654 CCCGGCGGGCGCCGGCGCGCCCC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479205_1203479222 3 Left 1203479205 Un_GL000220v1:160651-160673 CCCCCCCCCCCACCCCACGTCTC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479214_1203479222 -6 Left 1203479214 Un_GL000220v1:160660-160682 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479207_1203479222 1 Left 1203479207 Un_GL000220v1:160653-160675 CCCCCCCCCACCCCACGTCTCGT No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479209_1203479222 -1 Left 1203479209 Un_GL000220v1:160655-160677 CCCCCCCACCCCACGTCTCGTCG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479203_1203479222 21 Left 1203479203 Un_GL000220v1:160633-160655 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479208_1203479222 0 Left 1203479208 Un_GL000220v1:160654-160676 CCCCCCCCACCCCACGTCTCGTC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479213_1203479222 -5 Left 1203479213 Un_GL000220v1:160659-160681 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479204_1203479222 11 Left 1203479204 Un_GL000220v1:160643-160665 CCGGCGCGCCCCCCCCCCCACCC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479206_1203479222 2 Left 1203479206 Un_GL000220v1:160652-160674 CCCCCCCCCCACCCCACGTCTCG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479216_1203479222 -10 Left 1203479216 Un_GL000220v1:160664-160686 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479211_1203479222 -3 Left 1203479211 Un_GL000220v1:160657-160679 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479215_1203479222 -9 Left 1203479215 Un_GL000220v1:160663-160685 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data
1203479212_1203479222 -4 Left 1203479212 Un_GL000220v1:160658-160680 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203479222 Original CRISPR GCGCGCGCGTCCGCTGGGGG CGG Intergenic
No off target data available for this crispr