ID: 1203479507

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:113-135
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203479495_1203479507 7 Left 1203479495 Un_GL000224v1:83-105 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data
1203479491_1203479507 22 Left 1203479491 Un_GL000224v1:68-90 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data
1203479490_1203479507 23 Left 1203479490 Un_GL000224v1:67-89 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data
1203479498_1203479507 5 Left 1203479498 Un_GL000224v1:85-107 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data
1203479497_1203479507 6 Left 1203479497 Un_GL000224v1:84-106 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data
1203479489_1203479507 29 Left 1203479489 Un_GL000224v1:61-83 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203479507 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr