ID: 1203480082

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:4285-4307
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203480081_1203480082 -5 Left 1203480081 Un_GL000224v1:4267-4289 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203480082 Un_GL000224v1:4285-4307 GTGTGACAGTAGCAAGTAGATGG No data
1203480079_1203480082 7 Left 1203480079 Un_GL000224v1:4255-4277 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203480082 Un_GL000224v1:4285-4307 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203480082 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr