ID: 1203480473

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:6409-6431
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203480455_1203480473 29 Left 1203480455 Un_GL000224v1:6357-6379 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data
1203480461_1203480473 7 Left 1203480461 Un_GL000224v1:6379-6401 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data
1203480464_1203480473 5 Left 1203480464 Un_GL000224v1:6381-6403 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data
1203480456_1203480473 23 Left 1203480456 Un_GL000224v1:6363-6385 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data
1203480463_1203480473 6 Left 1203480463 Un_GL000224v1:6380-6402 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data
1203480457_1203480473 22 Left 1203480457 Un_GL000224v1:6364-6386 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203480473 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr