ID: 1203481440

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:12737-12759
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203481430_1203481440 6 Left 1203481430 Un_GL000224v1:12708-12730 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data
1203481428_1203481440 7 Left 1203481428 Un_GL000224v1:12707-12729 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data
1203481422_1203481440 29 Left 1203481422 Un_GL000224v1:12685-12707 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data
1203481424_1203481440 22 Left 1203481424 Un_GL000224v1:12692-12714 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data
1203481423_1203481440 23 Left 1203481423 Un_GL000224v1:12691-12713 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data
1203481431_1203481440 5 Left 1203481431 Un_GL000224v1:12709-12731 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203481440 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr