ID: 1203482015

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:16922-16944
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203482012_1203482015 7 Left 1203482012 Un_GL000224v1:16892-16914 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203482015 Un_GL000224v1:16922-16944 GTGTGACAGTAGCAAGTAGATGG No data
1203482014_1203482015 -5 Left 1203482014 Un_GL000224v1:16904-16926 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203482015 Un_GL000224v1:16922-16944 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203482015 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr