ID: 1203482404

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:19046-19068
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203482392_1203482404 7 Left 1203482392 Un_GL000224v1:19016-19038 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data
1203482388_1203482404 22 Left 1203482388 Un_GL000224v1:19001-19023 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data
1203482386_1203482404 29 Left 1203482386 Un_GL000224v1:18994-19016 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data
1203482395_1203482404 5 Left 1203482395 Un_GL000224v1:19018-19040 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data
1203482387_1203482404 23 Left 1203482387 Un_GL000224v1:19000-19022 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data
1203482394_1203482404 6 Left 1203482394 Un_GL000224v1:19017-19039 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203482404 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr