ID: 1203488534

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:81811-81833
Sequence ATGGATACACAGTTTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203488534_1203488537 25 Left 1203488534 Un_GL000224v1:81811-81833 CCCTTTTTAAACTGTGTATCCAT No data
Right 1203488537 Un_GL000224v1:81859-81881 AACTCCTAACAGAATAATGCCGG 0: 9
1: 13
2: 21
3: 37
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203488534 Original CRISPR ATGGATACACAGTTTAAAAA GGG (reversed) Intergenic
No off target data available for this crispr