ID: 1203492345

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:118994-119016
Sequence GTGGGGAAGGGGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203492324_1203492345 30 Left 1203492324 Un_GL000224v1:118941-118963 CCCGCTCTGGACGGTTCGCCAAA No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492329_1203492345 7 Left 1203492329 Un_GL000224v1:118964-118986 CCTGCCCCAGGAGGTTGCTGCAG No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492328_1203492345 12 Left 1203492328 Un_GL000224v1:118959-118981 CCAAACCTGCCCCAGGAGGTTGC No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492333_1203492345 1 Left 1203492333 Un_GL000224v1:118970-118992 CCAGGAGGTTGCTGCAGGAGCTG No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492325_1203492345 29 Left 1203492325 Un_GL000224v1:118942-118964 CCGCTCTGGACGGTTCGCCAAAC No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492332_1203492345 2 Left 1203492332 Un_GL000224v1:118969-118991 CCCAGGAGGTTGCTGCAGGAGCT No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data
1203492331_1203492345 3 Left 1203492331 Un_GL000224v1:118968-118990 CCCCAGGAGGTTGCTGCAGGAGC No data
Right 1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203492345 Original CRISPR GTGGGGAAGGGGAGGGATGA GGG Intergenic
No off target data available for this crispr