ID: 1203493116

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:125470-125492
Sequence AAGAACATTCAGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203493116_1203493120 11 Left 1203493116 Un_GL000224v1:125470-125492 CCTGCTGTCTTCTGAATGTTCTT No data
Right 1203493120 Un_GL000224v1:125504-125526 ATTCCAGAACATTACTACGAGGG No data
1203493116_1203493119 10 Left 1203493116 Un_GL000224v1:125470-125492 CCTGCTGTCTTCTGAATGTTCTT No data
Right 1203493119 Un_GL000224v1:125503-125525 GATTCCAGAACATTACTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203493116 Original CRISPR AAGAACATTCAGAAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr