ID: 1203498817

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000224v1:179152-179174
Sequence GTGTTGTGGAACCCTATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203498815_1203498817 13 Left 1203498815 Un_GL000224v1:179116-179138 CCTATGTGAGGGATAAACATTCA No data
Right 1203498817 Un_GL000224v1:179152-179174 GTGTTGTGGAACCCTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203498817 Original CRISPR GTGTTGTGGAACCCTATCTG AGG Intergenic